Learn to Build DNA
Ever wonder how scientists make a jellyfish protein glow inside bacteria? Follow along as we design a real gene from scratch — step by step.
Start the JourneyStep 1
Find Your Sequence
Green Fluorescent Protein (GFP) was first discovered in the jellyfish Aequorea victoria. Scientists share gene sequences in public databases like NCBI GenBank and Addgene so anyone can look them up. Here’s what a snippet of the GFP gene looks like in FASTA format:
>GFP_Aequorea_victoria
ATGAGTAAAGGAGAAGAA CTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAA TTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTT ATTTGCACTACTGGAAAACTACCTGTTCCA...
That ATG at the start? That’s the “start codon” — the universal signal that tells a cell “begin reading here.”
Step 2
Break It Down
DNA synthesis machines can only build short stretches at a time — usually 40 to 60 bases. So we split the full gene into short, overlapping pieces called oligonucleotides (or “oligos” for short).
...and so on
Notice how each piece overlaps with the next? Those overlapping ends are what let us stitch them back together in the right order.
Step 3
Stitch It Together
Think of it like a molecular jigsaw puzzle. Enzymes called polymerases and ligases read the overlapping ends and join each oligo to its neighbor, rebuilding the full gene one piece at a time.
This process — called polymerase cycling assembly — is essentially PCR on steroids. In a couple of hours you go from a tube of short oligos to a complete, full-length gene.
Step 4
Build Your Plasmid
A loose gene by itself won’t do anything inside a cell. You need to insert it into a plasmid — a small, circular piece of DNA that bacteria can copy and read.
Modern assembly methods like Gibson Assembly and Golden Gate cloning let you snap the gene into the plasmid in a single reaction — no scissors-and-glue required. The plasmid adds a promoter (an “on switch”), a terminator (a “stop sign”), and an antibiotic resistance marker so you can tell which bacteria got the plasmid.
Step 5
Make It Glow!
Transform the plasmid into E. coli bacteria, grow them overnight, and shine a UV light on the plate. If everything worked, you’ll see colonies glowing bright green — each one a tiny factory producing your jellyfish protein.
Congratulations — you just built a living thing that glows!
Ready to Try It Yourself?
Use these free tools to start exploring real DNA sequences. No sign-up, no install — just paste a sequence and go.